View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3288_high_32 (Length: 244)
Name: NF3288_high_32
Description: NF3288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3288_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 14138955 - 14138724
Alignment:
| Q |
1 |
ccatccacaaaataaacagattacaaatgcaatagaaagattacaaatgcagtaaaagcagttctaaagatagcaaaattatgtatcaattaatcaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14138955 |
ccatccacaaaataaacagattacaaatgcaatagaaagattacaaatgcagtaaaagcagttctaaagatagcaaaattatgtatcaattaatcaaact |
14138856 |
T |
|
| Q |
101 |
gaaacactatcacatggttc--nnnnnnnatccttgtagttaataattaatttaccactttaagatttatcctcttgcagtaagcaatgaaggaacagct |
198 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14138855 |
gaaacactatcacatggttctttttttttatccttgtagttaataattaatttaccactgtaagatttatcctcttgcagtaagcaatgaaggaacagct |
14138756 |
T |
|
| Q |
199 |
gacaaatttggtgtcttctcagaagtgctttt |
230 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
14138755 |
gacaaatttggtgtcttctcagaagtgttttt |
14138724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University