View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3288_high_38 (Length: 221)

Name: NF3288_high_38
Description: NF3288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3288_high_38
NF3288_high_38
[»] chr8 (1 HSPs)
chr8 (124-206)||(36850650-36850734)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 124 - 206
Target Start/End: Complemental strand, 36850734 - 36850650
Alignment:
124 ttgaactatgctcagtgaggtg--cgccagtcaattttgtgatagaggaagagggtcaacagtctttgccattaaggaataaact 206  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
36850734 ttgaactatgctcagtgaggtgtgcgccagtcaattttgtgatagaggaagagggtcagcagtctttgccattaaggaataaact 36850650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University