View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3288_high_39 (Length: 215)
Name: NF3288_high_39
Description: NF3288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3288_high_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 141 - 198
Target Start/End: Complemental strand, 4020652 - 4020595
Alignment:
| Q |
141 |
ccacttagtgcagattagccctattcgctaaatccaaccaaatattttagatcctctc |
198 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
4020652 |
ccacttagtgcagattatccctattcactaaatccaaccaaataatttagatcctctc |
4020595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 141 - 178
Target Start/End: Original strand, 3960667 - 3960704
Alignment:
| Q |
141 |
ccacttagtgcagattagccctattcgctaaatccaac |
178 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3960667 |
ccacttagttcagattagccctattcgctaaatccaac |
3960704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University