View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3288_low_11 (Length: 428)
Name: NF3288_low_11
Description: NF3288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3288_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 378; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 7 - 412
Target Start/End: Complemental strand, 8999358 - 8998953
Alignment:
| Q |
7 |
catcatcattccgagcatgaacatgttcattcatggcgattcatcatctttcaatctcaaaacccagtaaagctcaacatccaaatgaatggccagaatc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8999358 |
catcatcattccgagcatgaacatgttcattcatggcgattcatcatctttcaatctcaaaacccagtaaagctcaacatccaaatgaatggccagaatc |
8999259 |
T |
 |
| Q |
107 |
tactctcgcaactttttccccttccgtaccaccttcttctcacgccccatcacttcttcctcttcatcttcaccatcttcacaattcctaactcatcttc |
206 |
Q |
| |
|
||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8999258 |
tactctcgcaacttttttcccttccgtaaccccttcttctcacgccccatcacttcttcctcttcatcttcaccatcttcacaattcctaactcatcttc |
8999159 |
T |
 |
| Q |
207 |
attttcaatcactacttaaaccttctcattgccaaaccactcaccaccttcttcaaatccaagcccttctcatcacttcaagcttttaccgcaacccctt |
306 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8999158 |
attttcaatcactacttcaaccttctcattgccaaaccactcaccaccttcttcaaatccaatccctgctcatcacttcaagcttttaccgcaacccctt |
8999059 |
T |
 |
| Q |
307 |
tttatcacgcacccttttaagccgcgcttctaatctttgcacagttgatttcactattcttatttttcaccatttcaataaccctttagatactttctgt |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8999058 |
tttatcacgcacccttttaagccgcgcttctaatctttgcacagttgatttcacttttcttatttttcaccatttcaataaccctttagatactttctgt |
8998959 |
T |
 |
| Q |
407 |
gtcaac |
412 |
Q |
| |
|
|||||| |
|
|
| T |
8998958 |
gtcaac |
8998953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University