View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3288_low_27 (Length: 286)
Name: NF3288_low_27
Description: NF3288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3288_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 17 - 285
Target Start/End: Original strand, 35891825 - 35892092
Alignment:
| Q |
17 |
aatttgaaaattaaccatgaaaaatgagggacattgattcaggtgcattaatttctaaataataatgcacccgtgtaatacatagaactagtactatttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35891825 |
aatttgaaaattaaccatgaaaaatgagggacattgattcaggtgcattaatttctaaataataatgcacccgtggaatacatagaactagtactatttt |
35891924 |
T |
 |
| Q |
117 |
taatgaatgggagatactactatctgagactgagctccagtatcaatgctgctttgtcttggcgtctgatagagagacgttggagattggtattctgttc |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35891925 |
taatgaatgg-agatactactatctgagactgagctccagtatcaatgctgctttgtcttggcgtctgatagagagacgttggagattggtattctgttc |
35892023 |
T |
 |
| Q |
217 |
cttcacacgttggaaccaagtcataatatcacctttttcttttctttattacttgtcccaaactaactg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35892024 |
cttcacacgttggaaccaagtcataatatcacctttttcttttctttattacttgtcccaaactaactg |
35892092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University