View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3288_low_39 (Length: 237)
Name: NF3288_low_39
Description: NF3288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3288_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 32 - 218
Target Start/End: Complemental strand, 52088412 - 52088227
Alignment:
| Q |
32 |
ggacaaacagacacaaagcacccggtttgagtgatagcaatacaaataacaatatta---nnnnnnnnnnnnnnnnnagtaatatgatataaatcatata |
128 |
Q |
| |
|
||||||||||||||||| ||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
52088412 |
ggacaaacagacacaaaacaccccgttttagtgatagcaatacaaataacaatattaatgatgatgatgatgataatagtaatatgatataaatcataca |
52088313 |
T |
 |
| Q |
129 |
cacacaaagttttccaaatacactattatgagatctagtcatcagttagttagtacatgaactaacatcggttgtgtaggaggtggtaat |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52088312 |
cacacaaagttttccaaatacaccattatgagatctagtcatc----agttactacatgaactaacatcggttgtgtaggaggtggtaat |
52088227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University