View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3288_low_42 (Length: 215)

Name: NF3288_low_42
Description: NF3288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3288_low_42
NF3288_low_42
[»] chr4 (2 HSPs)
chr4 (141-198)||(4020595-4020652)
chr4 (141-178)||(3960667-3960704)


Alignment Details
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 141 - 198
Target Start/End: Complemental strand, 4020652 - 4020595
Alignment:
141 ccacttagtgcagattagccctattcgctaaatccaaccaaatattttagatcctctc 198  Q
    ||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||    
4020652 ccacttagtgcagattatccctattcactaaatccaaccaaataatttagatcctctc 4020595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 141 - 178
Target Start/End: Original strand, 3960667 - 3960704
Alignment:
141 ccacttagtgcagattagccctattcgctaaatccaac 178  Q
    ||||||||| ||||||||||||||||||||||||||||    
3960667 ccacttagttcagattagccctattcgctaaatccaac 3960704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University