View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3289_high_21 (Length: 220)

Name: NF3289_high_21
Description: NF3289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3289_high_21
NF3289_high_21
[»] chr1 (2 HSPs)
chr1 (136-200)||(9189500-9189564)
chr1 (47-131)||(9189617-9189701)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 136 - 200
Target Start/End: Complemental strand, 9189564 - 9189500
Alignment:
136 atatcttcctcgatggaggtatatgaaaacacaatagttgctaagaccacacaacttttcttatc 200  Q
    ||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||    
9189564 atatcttcctcgatggaggtatatgaaaacacaataggtactaagaccacactacttttcttatc 9189500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 47 - 131
Target Start/End: Complemental strand, 9189701 - 9189617
Alignment:
47 tttatattgaactaaacgagacaagtcattgattcaagttcaatttagttctaacatgaatagccaataaaaaattggaattttc 131  Q
    |||||||  ||||||| |||||||||| ||||||||| |||| ||||||||||||||||| | ||||| |||| |||||||||||    
9189701 tttatatcaaactaaatgagacaagtcgttgattcaaattcactttagttctaacatgaaaatccaattaaaatttggaattttc 9189617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University