View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3289_low_22 (Length: 236)
Name: NF3289_low_22
Description: NF3289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3289_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 43725973 - 43725755
Alignment:
| Q |
1 |
cttgaacttacaatcatacctccgtttccatatggatcaatagtgaatgttgaattaggaacatctatcttttcacctcccactttaattccttttagtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43725973 |
cttgaacttacaatcatacctccgtttccatatggatcaatagtgaatgttgaattaggaacatcgatcttttcacctcccactttaattccttttagtc |
43725874 |
T |
|
| Q |
101 |
ccacatagtataaattctcagccttcggattttgcaacaacttagctttaaccgaaccactacatggcggcgaattgaattccaaagttgacgacgaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43725873 |
ccacatagtataaattctcagccttcggattttgcaacaacttagctttaaccgaaccactacatggcggcgaattgaattccaaagttgacgacgaata |
43725774 |
T |
|
| Q |
201 |
tccatctttactttccact |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
43725773 |
tccatctttactttccact |
43725755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University