View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3289_low_23 (Length: 220)
Name: NF3289_low_23
Description: NF3289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3289_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 136 - 200
Target Start/End: Complemental strand, 9189564 - 9189500
Alignment:
| Q |
136 |
atatcttcctcgatggaggtatatgaaaacacaatagttgctaagaccacacaacttttcttatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||| |
|
|
| T |
9189564 |
atatcttcctcgatggaggtatatgaaaacacaataggtactaagaccacactacttttcttatc |
9189500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 47 - 131
Target Start/End: Complemental strand, 9189701 - 9189617
Alignment:
| Q |
47 |
tttatattgaactaaacgagacaagtcattgattcaagttcaatttagttctaacatgaatagccaataaaaaattggaattttc |
131 |
Q |
| |
|
||||||| ||||||| |||||||||| ||||||||| |||| ||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
9189701 |
tttatatcaaactaaatgagacaagtcgttgattcaaattcactttagttctaacatgaaaatccaattaaaatttggaattttc |
9189617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University