View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3290_high_10 (Length: 379)
Name: NF3290_high_10
Description: NF3290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3290_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 6e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 138 - 356
Target Start/End: Complemental strand, 41144940 - 41144722
Alignment:
| Q |
138 |
attgcagttaaaaagccgtgtcacacaaaactaatttgttatttaagtgtcggtcctagaaactgatcctatttcatttgggttgattgttattgcttct |
237 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||| ||||| |||| |||| ||||||||||||||||||| |||| |
|
|
| T |
41144940 |
attgcagttgaaaagccgtgtcacacaaaactaatttgttatttaagtttcagtcctaggaactgctcctgtttcgtttgggttgattgttattgattct |
41144841 |
T |
|
| Q |
238 |
tcatactcattgcttatgaattgtaaggctttagtgggaacagtatggtgactctgctcccggattgcaacgtgttgccatcagaatactaagtcaagtt |
337 |
Q |
| |
|
|||||| |||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41144840 |
tcatacccattgcttatgaattgtagggctttggtgggaacagtatggtgactctgctcccgggttgcaacgagttgccatcagaatactaagtcaagtt |
41144741 |
T |
|
| Q |
338 |
tgtaacactttctcatttc |
356 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
41144740 |
tgtagcactttctcatttc |
41144722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 84; Significance: 8e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 88 - 183
Target Start/End: Complemental strand, 24327351 - 24327257
Alignment:
| Q |
88 |
tggctccatgatcatctgagaagacttgctcttagtttcttatctaaagaattgcagttaaaaagccgtgtcacacaaaactaatttgttatttaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24327351 |
tggctccatgatcatctgagaagacttgctctt-gtttcttatctaaagaattgcagttgaaaagccgtgtcacacaaaactaatttgttatttaa |
24327257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 281
Target Start/End: Complemental strand, 24327213 - 24327181
Alignment:
| Q |
249 |
gcttatgaattgtaaggctttagtgggaacagt |
281 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
24327213 |
gcttatgaattgtagggctttagtgggaacagt |
24327181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University