View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3290_high_19 (Length: 258)
Name: NF3290_high_19
Description: NF3290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3290_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 64 - 245
Target Start/End: Original strand, 12873082 - 12873263
Alignment:
| Q |
64 |
attaagtgggtgttacattgtttatatcctttctatatgtggtcttaatctttttagtcaacgtttgtggtcttaatatcaagaatctcactttctttta |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12873082 |
attaagtgggtgttacattgtttatatcctttctatatgtggtcttaatctttttagtcaacgtttgtggtcttaatatcaagaatctcactttctttta |
12873181 |
T |
 |
| Q |
164 |
caatacaatcagagttgtactgagggataaaaaatcaacaacaatgactagcaaaaggggaaataagcatacactctctgct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12873182 |
caatacaatcagagttgtactgagggataaaaattcaacaacaatgactagcaaaaggggaaataagcatacactctctgct |
12873263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University