View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3290_high_22 (Length: 237)
Name: NF3290_high_22
Description: NF3290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3290_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 54088546 - 54088374
Alignment:
| Q |
1 |
tcagaacccgctccagaagaccctgacccagcatgagaacctgcatatgaaccggcttcagaacctgctcctgacccagcccctgaccctgcacgagatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54088546 |
tcagaacccgctccagaagaccctgacccagcatgagaacctgcatatgaaccggcttcagaacctgctcctgacccagcccctgaccctgcacgagatc |
54088447 |
T |
|
| Q |
101 |
ctgcatgggagctggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaagtggaagccga |
173 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54088446 |
ctgcatgggagccggcttcagaacctgctccagaagaccctgatcccgatcctgatcctgaagtggaagccga |
54088374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 54088615 - 54088547
Alignment:
| Q |
1 |
tcagaacccgctccagaagaccctgacccagcatgagaacctgcatatgaaccggcttcagaacctgct |
69 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54088615 |
tcagagcccgctctagaagaccctgacccagcatgagaccctgcatatgaaccggcttcagaacctgct |
54088547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 135
Target Start/End: Complemental strand, 54088651 - 54088541
Alignment:
| Q |
22 |
cctgacccagcatgagaacctgcatatgaaccggcttcagaacctgctcctgacccagcccctgaccctgcacgagatcctgcatgggagctggcttcag |
121 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||||||| || |||| || || ||||||||| ||| |||| ||||||| || | |||||||| |
|
|
| T |
54088651 |
cctgatccagcatgagatcctgcatatgaaccagcttcagagcccgctctaga---agaccctgacccagcatgagaccctgcatatgaaccggcttcag |
54088555 |
T |
|
| Q |
122 |
aacctgctccagaa |
135 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
54088554 |
aacctgcttcagaa |
54088541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University