View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3290_high_23 (Length: 221)
Name: NF3290_high_23
Description: NF3290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3290_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 10024877 - 10024689
Alignment:
| Q |
15 |
caaaggtacaagaaacttacatgtgccatctcacacactttatgctgacaatgtgatgatattttgcaaagggaaaaagtcttgccttctgactcttaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10024877 |
caaaggtacaagaaacttacatgtgccatctcacacactttatgctgacaatgtgatgatattttgcaaagggaaaaagtcttgccttctgactctta-- |
10024780 |
T |
 |
| Q |
115 |
caacttttcattgattatgcagcctgttatggttagattattaacccttttaagcca---------actggttccattaatgctagcagactatct |
201 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10024779 |
-aacttttcattgattatgcagcctgtt----ttagattattaacccttttaagccaactttgtacactggttccattaatgctagcagactatct |
10024689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University