View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3291-Insertion-16 (Length: 384)
Name: NF3291-Insertion-16
Description: NF3291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3291-Insertion-16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 97 - 242
Target Start/End: Complemental strand, 19331578 - 19331433
Alignment:
| Q |
97 |
tcagtccaaaatcccttataattacaattttccttgccactcaaaaaatgaaggaacttcttgatacagagtaattaaaatttaattaattatcatgttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
19331578 |
tcagtccaaaatcccttataattacaattttccttgccactcaaaaaatgaaggaacttcttgattgagagtaattaaaatttaattaaatatcatgttt |
19331479 |
T |
 |
| Q |
197 |
tcaactctctcctgctagaccttatagtttttatattcaatactag |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19331478 |
tcaactctctcctgctagaccttatagtttttatattcaatactag |
19331433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University