View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3291-Insertion-19 (Length: 189)
Name: NF3291-Insertion-19
Description: NF3291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3291-Insertion-19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 7e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 7e-57
Query Start/End: Original strand, 8 - 123
Target Start/End: Complemental strand, 40565039 - 40564924
Alignment:
| Q |
8 |
aaaggaaccaagaatggtgacaacgttgtctgtaattgtttggcttttttgaagagactctctcatcatagctgcttttacactcagtgaatcagtacca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40565039 |
aaaggaaccaagaatggtgacaacgttgtctgtaattgtttggcttttttgaagagactctctcatcatagctgcttttacgctcagtgaatcagtacca |
40564940 |
T |
|
| Q |
108 |
cccattgctataccca |
123 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40564939 |
cccattgctataccca |
40564924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 189
Target Start/End: Complemental strand, 40564902 - 40564857
Alignment:
| Q |
144 |
tagttgtttcagacaaagatgaacgaaatcacaagttattgaattt |
189 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
40564902 |
tagttgtttcagacaaagatgaacaaaatcgcaagttattgaattt |
40564857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University