View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3291R-Insertion-3 (Length: 975)
Name: NF3291R-Insertion-3
Description: NF3291R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3291R-Insertion-3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 5e-37; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 5e-37
Query Start/End: Original strand, 41 - 131
Target Start/End: Complemental strand, 33250397 - 33250304
Alignment:
| Q |
41 |
tggaaagagtgtttaatttgtgagttatgtatgtcactcaagcggggaagc---ggatttgtatcctctcctaccatttcttttatgttgttgg |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33250397 |
tggaaagagtgtttaatttgtgagttatgtatgtcactcaagcggggaagcataggatttgtatcctctcctaccatttcttttatgttgttgg |
33250304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 596 - 658
Target Start/End: Complemental strand, 33250225 - 33250164
Alignment:
| Q |
596 |
ctagccggctaacttcaatccgaagtttattgagcactcattcgttccgcaacgctcgacata |
658 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||| |
|
|
| T |
33250225 |
ctagccggctaacttcaatccgaagttcattgagcactca-tcgttccgcaacgcttgacata |
33250164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 903 - 951
Target Start/End: Complemental strand, 33250039 - 33249992
Alignment:
| Q |
903 |
gttgtttctgattagagaattgccctgcaaatagatgataccctcacgc |
951 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||| ||||||||| |
|
|
| T |
33250039 |
gttgtttctgattagagaattgccctgc-agtagatgattccctcacgc |
33249992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 500 - 541
Target Start/End: Original strand, 24413232 - 24413273
Alignment:
| Q |
500 |
aggaagtgaaaccttgcttctatgtgtttccttcctccatgt |
541 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
24413232 |
aggaagtgaaaccttgcttctatgtgtttacttattccatgt |
24413273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University