View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3291R-Insertion-3 (Length: 975)

Name: NF3291R-Insertion-3
Description: NF3291R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3291R-Insertion-3
NF3291R-Insertion-3
[»] chr4 (4 HSPs)
chr4 (41-131)||(33250304-33250397)
chr4 (596-658)||(33250164-33250225)
chr4 (903-951)||(33249992-33250039)
chr4 (500-541)||(24413232-24413273)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 5e-37; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 5e-37
Query Start/End: Original strand, 41 - 131
Target Start/End: Complemental strand, 33250397 - 33250304
Alignment:
41 tggaaagagtgtttaatttgtgagttatgtatgtcactcaagcggggaagc---ggatttgtatcctctcctaccatttcttttatgttgttgg 131  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||    
33250397 tggaaagagtgtttaatttgtgagttatgtatgtcactcaagcggggaagcataggatttgtatcctctcctaccatttcttttatgttgttgg 33250304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 596 - 658
Target Start/End: Complemental strand, 33250225 - 33250164
Alignment:
596 ctagccggctaacttcaatccgaagtttattgagcactcattcgttccgcaacgctcgacata 658  Q
    ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||    
33250225 ctagccggctaacttcaatccgaagttcattgagcactca-tcgttccgcaacgcttgacata 33250164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 903 - 951
Target Start/End: Complemental strand, 33250039 - 33249992
Alignment:
903 gttgtttctgattagagaattgccctgcaaatagatgataccctcacgc 951  Q
    |||||||||||||||||||||||||||| | |||||||| |||||||||    
33250039 gttgtttctgattagagaattgccctgc-agtagatgattccctcacgc 33249992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 500 - 541
Target Start/End: Original strand, 24413232 - 24413273
Alignment:
500 aggaagtgaaaccttgcttctatgtgtttccttcctccatgt 541  Q
    ||||||||||||||||||||||||||||| |||  |||||||    
24413232 aggaagtgaaaccttgcttctatgtgtttacttattccatgt 24413273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University