View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3291_high_20 (Length: 247)
Name: NF3291_high_20
Description: NF3291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3291_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 24 - 232
Target Start/End: Original strand, 24834111 - 24834320
Alignment:
| Q |
24 |
gtgatcccaactgagccacctcatgcacaccaacctcttgctcctgaagattactagttacctacttctgtttatcattgtgtgtttgtcattagtgtct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24834111 |
gtgatcccaactgagccacctcatgcacaccagcctcttgctcctgaagattactagttacctacttctgtttatcattgtgtgtttgtcattagtgtct |
24834210 |
T |
 |
| Q |
124 |
tgtttgttgtatcatttcgtttttacgac-nnnnnnnngtttagtttcaattgagccaatatgctgtatttttctactgttcttggggtctcagcttatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24834211 |
tgtttgttgtatcatttcgtttttacgacttttttttggtttagtttcaattgagccaatatgctgtatttttctactgttcttggggtctcagcttatg |
24834310 |
T |
 |
| Q |
223 |
tgtatctgtg |
232 |
Q |
| |
|
|||||||||| |
|
|
| T |
24834311 |
tgtatctgtg |
24834320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University