View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3291_low_13 (Length: 324)
Name: NF3291_low_13
Description: NF3291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3291_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 227
Target Start/End: Complemental strand, 7640222 - 7640010
Alignment:
| Q |
13 |
aatatacacttctacaaacttcaagcttattttctataaaatctcactacatggtaaagaattcgacttcagggaagcaaaatttgcaataatatctata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7640222 |
aatatacacttctacaaacttcaagcttattttctataaaatctcactacatgg--aagaattcgacttcagggaaacaaaatttgcaataatatctata |
7640125 |
T |
|
| Q |
113 |
tataaactgattccattcacaatgtcgtctatgctcaataaactagtcttggcattctaactaggtgaagccatttaatttgggaataaagttagatgaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7640124 |
tataaactgattccattcacaatgtcgtctatgctcaataaactagtcttggcattctaactaggtgaagccatttaatttgggaataaagttagatgaa |
7640025 |
T |
|
| Q |
213 |
taaattgaatccctt |
227 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
7640024 |
tattttgaatccctt |
7640010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 99 - 193
Target Start/End: Complemental strand, 7633379 - 7633288
Alignment:
| Q |
99 |
caataatatctatatataaactgattccattcacaatgtcgtctatgctcaataaactagtcttggcattctaactaggtgaagccatttaattt |
193 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||| ||||||| |||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
7633379 |
caataatatctatatataaactgaatccattcagaatgtg---tatgctccataaactagtattggcattccaactaggtgaagccatttaattt |
7633288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 265 - 307
Target Start/End: Complemental strand, 7639980 - 7639938
Alignment:
| Q |
265 |
tgtctactgaaatgtcatgagacagctttcggggcatacagct |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7639980 |
tgtctactgaaatgtcatgagacagctttcggggcatacagct |
7639938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University