View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3291_low_14 (Length: 315)
Name: NF3291_low_14
Description: NF3291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3291_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 16 - 291
Target Start/End: Original strand, 12512928 - 12513203
Alignment:
| Q |
16 |
caaaatccctttttaagttttcaagtcaatctcctaattttcagtgattcttgtgacaaaaccatttccaagtcaaaaatatcctcgaaattcaaatatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12512928 |
caaaatccctttttaagttttcaagtcaatctcctaattttcagtgattcttgtgacaaaaccatttccaagtcaataatatcctcgaaattcaaatatt |
12513027 |
T |
 |
| Q |
116 |
tcatataagagcagcagtaactaagaacaatataaataacttcttccagattcatacccctaatacaatacaaataacttttttcagattcatacaccta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12513028 |
tcatataagagcagcagtaactaagaacaatacaaataacttcttccagattaatatccctaatacaatacaactaacttttttcagattcatacaccta |
12513127 |
T |
 |
| Q |
216 |
aagcaactctcacattatattgtgtaccatgcacaggtgtagcaagctcttgctgcaacctttctccaacaattgg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12513128 |
aagcaactctcacattatattgtgtaccatgcacaggtgtagcaagctcttgctgcaacctttctccaacgattgg |
12513203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University