View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3291_low_15 (Length: 298)
Name: NF3291_low_15
Description: NF3291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3291_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 12 - 281
Target Start/End: Original strand, 4601348 - 4601621
Alignment:
| Q |
12 |
atgagtcggacaccggatat----gccgtccatcaaccgctagtctgcatgcattccttcattcaaccactatcaatttttcaaattattatccctgtcc |
107 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4601348 |
atgagtcggacaccggatatatatgccgtccatcaaccgctagtctgcatgcattccttcattcaaccactatcaatttttcaaattattatccctgtcc |
4601447 |
T |
 |
| Q |
108 |
atgtgtgtttagtctaacatcgctgtcaataccgaccctttttcagggtttcaataccattaacatacatcttttacctgatcattttattcaaaccagt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4601448 |
atgtgtgtttagtctaacatcgctgtcaataccgaacctttttcagggtttcaataccattaacataaatcttttacctgatcattttattcaaaccagt |
4601547 |
T |
 |
| Q |
208 |
gttacaattaacagcatccttatatatacatacataaaataaaataaaaattgtcttgatacaaatctatgaag |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4601548 |
gttacaattaacagcatccttatatatacatacataaaataaaataaaaattgtcttgatacaaatctatgaag |
4601621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University