View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3291_low_24 (Length: 228)
Name: NF3291_low_24
Description: NF3291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3291_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 124 - 214
Target Start/End: Original strand, 3989839 - 3989929
Alignment:
| Q |
124 |
cactcacatttgcaacagtattattgacactttctttcttcttaactcccgcaatagtccatgtgcttaactggtgctttgaaattctctg |
214 |
Q |
| |
|
||||||| |||| ||| |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3989839 |
cactcacctttgtgacaatattattgacgctttctttcttcttaactcctgcaatagtccatgtgcttaactggtgctttgaaattctctg |
3989929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University