View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3291_low_26 (Length: 209)
Name: NF3291_low_26
Description: NF3291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3291_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 24425814 - 24425871
Alignment:
| Q |
18 |
acattcagacattattctcaacactcgcacgtccatataaatttgataacattgtcac |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24425814 |
acattcagacattattctcaacactcgcacgtccatataaatttgataacattgtcac |
24425871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 143 - 191
Target Start/End: Original strand, 24425943 - 24425991
Alignment:
| Q |
143 |
ataatcactggttacacattaacaaataacactaaactactatgaccct |
191 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
24425943 |
ataatcattggttacacattaacaaataacactaaactaccataaccct |
24425991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University