View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3292_low_6 (Length: 203)
Name: NF3292_low_6
Description: NF3292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3292_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 39987194 - 39987360
Alignment:
| Q |
20 |
aactgataattactctttctcaccctcccatgattacttcaactttgaactttccgctaactcttggtcacaaaacatcctccttgaaactgcacgtgca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39987194 |
aactgataattactctttctcaccctcccatgattacttcaactttgaattctccggtcactcttggtcacaaaacatcctccttgaaactgcacgtgca |
39987293 |
T |
|
| Q |
120 |
ttttccgacaatcacacaaaccgaatccaacaactcatgtggatgctaaacgagcttagtaccccat |
186 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39987294 |
ttttccgacaataacacaaaccgaatccaacaactcatgtggatgctaaacgagcttagtaccccat |
39987360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University