View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3294_high_4 (Length: 244)
Name: NF3294_high_4
Description: NF3294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3294_high_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 105 - 244
Target Start/End: Original strand, 44651583 - 44651722
Alignment:
| Q |
105 |
aacacccctagtgaatattatctcgcatcatgttatctttttataagaggtggaggatgtaannnnnnnnnnnnnnnnnnnngaaaacttggcgtttaac |
204 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44651583 |
aacacccctagtaaatattatctcgcatcatgttatctttttataagaggtggaggatgtaattttttttattttttattttgaaaacttggcgtttaac |
44651682 |
T |
 |
| Q |
205 |
tacattttggagttcatgttccttagtttatggcattagt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44651683 |
tacattttggagttcatgttccttagtttatggcattagt |
44651722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University