View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3295_high_21 (Length: 256)
Name: NF3295_high_21
Description: NF3295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3295_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 6400675 - 6400434
Alignment:
| Q |
11 |
tatgcaagtccaattgagtctgttatgtcccttttacttttgacagataacgggcttttgtttctttgaatagctcgatatttcattatattgtatggag |
110 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6400675 |
tatgcaagtccaattgagcctgttatgtcccttttacttttgacagataacgggcttttgtttctttgaatagctcgatattacattatattgtatggag |
6400576 |
T |
 |
| Q |
111 |
caggttcaaactataatttagttcatttagtgtttgaccatgattgtgagggattaagggatggtgaggtctacgatgttcaaacctttggcaatactgc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6400575 |
caggttcaaactataatttagttcatttagtgtttgaccatgattgtgagggattaagggatggtgaggtctacggtgttcaaacctttggcaatactgc |
6400476 |
T |
 |
| Q |
211 |
agatgatccgtttgcatataaaacttatttcctatgcttctc |
252 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
6400475 |
agatgatccgtgtgcatataaaacttatttcctatgtttctc |
6400434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University