View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3295_high_23 (Length: 249)
Name: NF3295_high_23
Description: NF3295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3295_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 42684210 - 42684449
Alignment:
| Q |
1 |
atgtaaaaatggttagattttataagaaaagttgaacaaataacaataatgacaaccaaactataaatgatccagaatataatgattcaaccaaagataa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42684210 |
atgtaaaaatagttagattttataagaaaagttgaacaaataacaataatgacaaccaaactataaatgatccagaatataatgattcaaccaaagataa |
42684309 |
T |
 |
| Q |
101 |
attcagaatctatatgcataagaaatttcaaacaatcaaactaaaaacaaaaataaatagattatgggaataacaccgtgttttgttcacaaagttcgcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||| |
|
|
| T |
42684310 |
attcagaatctatatgcataagaaatttcaaacaatcaaactaaaaacaaaaataaatagattatgggaataacaccgttttttgttcacagagtttgcc |
42684409 |
T |
 |
| Q |
201 |
ctaagaaaatgccgacgttgcaggagaaaacacatctctg |
240 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
42684410 |
ctaagaaaatgccgatgttgcaggagaaaacacctctctg |
42684449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University