View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3295_low_15 (Length: 361)
Name: NF3295_low_15
Description: NF3295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3295_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 181 - 345
Target Start/End: Original strand, 16899295 - 16899459
Alignment:
| Q |
181 |
cctacacgtctctctcctttaaatatctataaaggtccgtttgatgcaagtaagcagaagaacaagacagacatttgagttactgacaattttttgtcat |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16899295 |
cctacacgtctctctcctttaaatatctataaaggtccgtttgatgcaagtaagcagaagaacaagacaaacatttgagttacagacaattttttgtcat |
16899394 |
T |
 |
| Q |
281 |
gatatttggtagacagtataaaacacaaacaaaacagtgaaatttactacgattttacttcttcc |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16899395 |
gatatttggtagacagtataaaacacaaacaaaacagtgaaatttactacgattttacttcttcc |
16899459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 16899133 - 16899231
Alignment:
| Q |
1 |
gaagataatgaaggacaaaactctcatttgaaatttaacacccctgtatctttagggttggtttaaaacctggaacatatgattaaaccgaaagagatc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||| |||||||||| |
|
|
| T |
16899133 |
gaagataatgaaggacaaaactctcatttgaaatttaacacccctgtatttttagggttggtttaaaatctagaacatatgattaaactgaaagagatc |
16899231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University