View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3295_low_18 (Length: 336)
Name: NF3295_low_18
Description: NF3295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3295_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 12 - 318
Target Start/End: Original strand, 49085129 - 49085435
Alignment:
| Q |
12 |
ggaggagcagagaaaacatgacggcagaatcgggaggtttgaacttcgatcttcccgaggatgtcgtgcaagtactaccgtcagatccatttgaacaact |
111 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49085129 |
ggaggaacaaagaaaacatgacggcagaatcgggaggtttgaacttcgatcttcccgaggatgtcatgcaagtactaccgtcagatccatttgaacaact |
49085228 |
T |
 |
| Q |
112 |
cgatgtagcgcgcaaaatcacatccattgctctatcgacacgtgtcaaagcccttgaattggagtcatcggaacttcgggccaagatcgccgagaaagat |
211 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
49085229 |
cgatgtagcgcgcaagatcacatccattgctctatcgacacgtgtcaaagcccttgaattggagtcatcggaacttcgcgccaagaccgccgagaaagat |
49085328 |
T |
 |
| Q |
212 |
gaactcatagcggaacttcagtctcagcttgagtctctcgacgtttccctctctcaaaccgccgacaatctcgtccgtgcagagcaagataaggtttaat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085329 |
gaactcatagcggaacttcagtctcagcttgagtctctcgacgtttccctctctcaaaccgccgacaatctcgtccgtgcagagcaagataaggtttaat |
49085428 |
T |
 |
| Q |
312 |
ttcccat |
318 |
Q |
| |
|
||||||| |
|
|
| T |
49085429 |
ttcccat |
49085435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 78 - 159
Target Start/End: Complemental strand, 6995744 - 6995663
Alignment:
| Q |
78 |
tgcaagtactaccgtcagatccatttgaacaactcgatgtagcgcgcaaaatcacatccattgctctatcgacacgtgtcaa |
159 |
Q |
| |
|
||||||| ||||| || ||||| || || ||||||||||| || ||||||||||| |||||||| || || ||||||||||| |
|
|
| T |
6995744 |
tgcaagttctaccatccgatcctttcgagcaactcgatgtggctcgcaaaatcacctccattgccctttcaacacgtgtcaa |
6995663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University