View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3295_low_18 (Length: 336)

Name: NF3295_low_18
Description: NF3295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3295_low_18
NF3295_low_18
[»] chr4 (1 HSPs)
chr4 (12-318)||(49085129-49085435)
[»] chr2 (1 HSPs)
chr2 (78-159)||(6995663-6995744)


Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 12 - 318
Target Start/End: Original strand, 49085129 - 49085435
Alignment:
12 ggaggagcagagaaaacatgacggcagaatcgggaggtttgaacttcgatcttcccgaggatgtcgtgcaagtactaccgtcagatccatttgaacaact 111  Q
    |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
49085129 ggaggaacaaagaaaacatgacggcagaatcgggaggtttgaacttcgatcttcccgaggatgtcatgcaagtactaccgtcagatccatttgaacaact 49085228  T
112 cgatgtagcgcgcaaaatcacatccattgctctatcgacacgtgtcaaagcccttgaattggagtcatcggaacttcgggccaagatcgccgagaaagat 211  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
49085229 cgatgtagcgcgcaagatcacatccattgctctatcgacacgtgtcaaagcccttgaattggagtcatcggaacttcgcgccaagaccgccgagaaagat 49085328  T
212 gaactcatagcggaacttcagtctcagcttgagtctctcgacgtttccctctctcaaaccgccgacaatctcgtccgtgcagagcaagataaggtttaat 311  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49085329 gaactcatagcggaacttcagtctcagcttgagtctctcgacgtttccctctctcaaaccgccgacaatctcgtccgtgcagagcaagataaggtttaat 49085428  T
312 ttcccat 318  Q
    |||||||    
49085429 ttcccat 49085435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 78 - 159
Target Start/End: Complemental strand, 6995744 - 6995663
Alignment:
78 tgcaagtactaccgtcagatccatttgaacaactcgatgtagcgcgcaaaatcacatccattgctctatcgacacgtgtcaa 159  Q
    ||||||| ||||| || ||||| || || ||||||||||| || ||||||||||| |||||||| || || |||||||||||    
6995744 tgcaagttctaccatccgatcctttcgagcaactcgatgtggctcgcaaaatcacctccattgccctttcaacacgtgtcaa 6995663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University