View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3295_low_22 (Length: 253)
Name: NF3295_low_22
Description: NF3295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3295_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 23 - 245
Target Start/End: Complemental strand, 16899014 - 16898792
Alignment:
| Q |
23 |
ttggttttgctgacttgcaatagataagtatgcagaatctaccttaagatctatctttctttgtttcttctagttctacaacataaaaataaaacactct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
16899014 |
ttggttttgctgacttgcaatagataagtatgcagaatctaccttaagatctatctttctttgtttcttctagttctacaacataaaaataaaatacctt |
16898915 |
T |
 |
| Q |
123 |
ttcaacatcaaacaacattaaaataactttgcatgcactttagtttatattatagtacaaaacaatccacttaaccatgtttttaactacaactaagtct |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16898914 |
ttcaacatcaaacaacattaaaataacattgcatgcactttagtttatattatagtacaaaacaatccacttaaccatgtttttaactacaactaagtct |
16898815 |
T |
 |
| Q |
223 |
tatatttcattacctttcatctc |
245 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
16898814 |
tatatttcatcacctttcatctc |
16898792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 242
Target Start/End: Complemental strand, 16901734 - 16901671
Alignment:
| Q |
178 |
tacaaaacaatccacttaaccatgtttttaactacaactaagtcttatatttcattacctttcat |
242 |
Q |
| |
|
||||| ||||||| ||||| |||||||| | | |||||||||||||||| ||||| ||||||||| |
|
|
| T |
16901734 |
tacaacacaatcc-cttaatcatgttttcatcaacaactaagtcttatacttcatcacctttcat |
16901671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University