View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_high_37 (Length: 340)
Name: NF3296_high_37
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_high_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 322
Target Start/End: Complemental strand, 4961036 - 4960719
Alignment:
| Q |
1 |
atttggagtgaacaacaatggaaatttaaattttagggtttctactacgtttatttgcaagagatcttggagaaaatccaaatttgagttttagggtttc |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4961036 |
atttggagcgaacaacaatggaaatttaaattttagggtttcttctacgtttatttgcatgagatcttggagaaaatccaaatttgagttttagggtttc |
4960937 |
T |
|
| Q |
101 |
ttctgcgtttcaaacagtttaactacctatttttgagtttatttatccgagagtcaagttggtgtggtggataagatttgctggatatttaatttctaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4960936 |
ttctgcgtttcaaacagtttaactacctatttttgagtttatttatccgagagtcaagttg--gtggtggataagatttgctggatatttaatttctaaa |
4960839 |
T |
|
| Q |
201 |
ggttgcagtgtagcacttagaacaagaaaaaactttggatttcaattgaataaaatgtgttaccccaaaacccttctttcccttaaaaaacacgctgtat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4960838 |
ggttgcagtgtagcacttagaacaagaaaaaactttggatttcaattgaataaaatgtgttaccccaaaacccttctttcccttaaaaaacacgttgtat |
4960739 |
T |
|
| Q |
301 |
cacacattttgggagtgtttcc |
322 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4960738 |
--cacattttgggagtgtttcc |
4960719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University