View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_high_45 (Length: 315)
Name: NF3296_high_45
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_high_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 26542468 - 26542754
Alignment:
| Q |
19 |
gattcaaattgtttgcagggtcttttttgaattctctcaattttcatgtagaaatcatttataatttggaaagtttttccaatctaattttaccgtaata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26542468 |
gattcaaattgtttgcagggtcttttttgaattctctcaattttcatgtagaaatcatttataatttggaaagtttttccaatctaattttaccgtaata |
26542567 |
T |
|
| Q |
119 |
aaaaacccaatccgtgagaagcatgcgatagtaggccgaataatcacgagctcggcacgagggcgagcaggaggaacatctcccccttatctgatattaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26542568 |
aaaaacccaatccgtgagaagcatgcgatagtaggccgaataatcacgagctcggcacaagggcgagcaggaggaacatctcccccttatctgatattaa |
26542667 |
T |
|
| Q |
219 |
aaggtcatgtgtatatggcactttgactaagtaccccctttttacatatgcactggattcggtcaagagagactgcaccatcctatg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26542668 |
aaggtcatgtgtatatggcactttgactaagtaccccctttttacatatgcactggattcggtcaagagagactgcaccatcctatg |
26542754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University