View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_high_63 (Length: 252)
Name: NF3296_high_63
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_high_63 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 15 - 252
Target Start/End: Original strand, 1223105 - 1223349
Alignment:
| Q |
15 |
aagaagcaatatacttgaatcagaaaaggtattaaaaagtgagtttgatatacttgaatatgttcagaatctgctggaattcagaatcccctggaaacaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1223105 |
aagaagcaatatacttgaatcagaaaaggtattaaaaagtgagtttgatatacttgaatatgttcagaagctgctggaattcagaatcccctggaaacaa |
1223204 |
T |
 |
| Q |
115 |
agcctgtcttctcaccatttcagctgcacnnnnnnncaaattcaattacattcaatcatatatacagaaagaa-------aagtatcaaaatcaccaaca |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
1223205 |
agcctgtcttctcaccatttcagctgcacaaaaaaacaaattcaattacattccatcatatataaagaaagaaaagtatcaagtatcaaaatcaccaaca |
1223304 |
T |
 |
| Q |
208 |
taacgcgttactccacctctatgccattaatttgattcctagagt |
252 |
Q |
| |
|
||| | ||| | ||| | | ||||| ||||||||||||||||||| |
|
|
| T |
1223305 |
taaagagttgccccaacacgatgcccttaatttgattcctagagt |
1223349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University