View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_high_81 (Length: 225)
Name: NF3296_high_81
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_high_81 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 24 - 160
Target Start/End: Complemental strand, 22979096 - 22978960
Alignment:
| Q |
24 |
gaacccttatctcactccttcgatgtgaacctctctatcaaaaccccattgcagaacctctccatgtttctcgaaagccccatcacctctcactcttcgt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22979096 |
gaacccttatctcactccttcgatgtgaacctctctatcaaaaccccattgcagaacctctccatgtttctcgaaagccccatcacctctcactcttcgt |
22978997 |
T |
 |
| Q |
124 |
tattcttcccctaccagaacctttgtcacgctcttca |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22978996 |
tattcttcccctaccagaacctttgtcacgctcttca |
22978960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 24 - 157
Target Start/End: Complemental strand, 38459090 - 38458957
Alignment:
| Q |
24 |
gaacccttatctcactccttcgatgtgaacctctctatcaaaaccccattgcagaacctctccatgtttctcgaaagccccatcacctctcactcttcgt |
123 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38459090 |
gaacccttatctctctccttcgatgtgaacctctctatcaaaaccccattgcagaacctctccatgtttctcgaaagccccatcacctctcactcttcgt |
38458991 |
T |
 |
| Q |
124 |
tattcttcccctaccagaacctttgtcacgctct |
157 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
38458990 |
tattcttcccctaccataacctttgtcacgctct |
38458957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 212
Target Start/End: Complemental strand, 22978943 - 22978906
Alignment:
| Q |
175 |
gcgcaacgcaaaccctcactgtaagcaaaaccctctct |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22978943 |
gcgcaacgcaaaccctcactgtatgcaaaaccctctct |
22978906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 212
Target Start/End: Original strand, 1123657 - 1123694
Alignment:
| Q |
175 |
gcgcaacgcaaaccctcactgtaagcaaaaccctctct |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1123657 |
gcgcaacgctaaccctcactgtaagcaaaaccctctct |
1123694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University