View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_high_9 (Length: 572)
Name: NF3296_high_9
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 288 - 562
Target Start/End: Original strand, 35786958 - 35787223
Alignment:
| Q |
288 |
ttaagctgagccctagaaccatagagaataatagcagcacgatcataagctttagcagcatcttcagcagttgaaaaagtaccaagccatttacgagtac |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786958 |
ttaagctgagccctagaaccatagagaataatagcagcacgatcataagctttagcagcatcttcagcagttgaaaaagtaccaagccatttacgagtac |
35787057 |
T |
 |
| Q |
388 |
gtttacgtggttcacgaatttcagcaacccatttaccccaactacgttgtcttacaccacggtatctgaatttgttgttatcaggtccacctttaccttt |
487 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787058 |
gtttacgtggttcacgaatttcagcaacccatttaccccaactacgttgtcttacaccacggtatctgaatttgttgttatcaggtccacctttaccttt |
35787157 |
T |
 |
| Q |
488 |
gcatttacggttacttttattgttgttggtgttgttggtagtgttactactgctgctgttattactgttgttatc |
562 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35787158 |
gcatttacggttacttttat---------tgttgttggtagtgttactgctgctgctgttattactgttgttatc |
35787223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 16 - 198
Target Start/End: Original strand, 35786686 - 35786868
Alignment:
| Q |
16 |
attgttgatggtgttgcacttgcacttgcaccatttcttgatgagggttatgatgaaaatgaactaaaccattattgttattatagaaaactggttggtg |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786686 |
attgttgatgctgttgcacttgcacttgcaccatttcttgatgagggttatgatgaaaatgaactaaaccattattgttattatagaaaactggttggtg |
35786785 |
T |
 |
| Q |
116 |
atgatgatgaaaattattgtaaacaccaaatgggacaaaattattgtaaactgagaaaccagaaggacgaggaagtaaaggac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786786 |
atgatgatgaaaattattgtaaacaccaaatgggacaaaattattgtaaactgagaaaccagaaggacgaggaagtaaaggac |
35786868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 395 - 428
Target Start/End: Original strand, 25896641 - 25896674
Alignment:
| Q |
395 |
tggttcacgaatttcagcaacccatttaccccaa |
428 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
25896641 |
tggttcacgaatctcagcaacccatttaccccaa |
25896674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 396 - 428
Target Start/End: Complemental strand, 52690586 - 52690554
Alignment:
| Q |
396 |
ggttcacgaatttcagcaacccatttaccccaa |
428 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
52690586 |
ggttcacggatttcagcaacccatttaccccaa |
52690554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University