View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_low_39 (Length: 333)
Name: NF3296_low_39
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 43 - 196
Target Start/End: Original strand, 6358338 - 6358491
Alignment:
| Q |
43 |
ccaaaggtttatgcttcaaaacataaattagttgataatgatatggggattacagaccactcacaaggttaagcttatggggatttacacattttgtttt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358338 |
ccaaaggtttatgcttcaaaacataaattagttgataatgatatggggattacagaccactcacaaggttaagcttatggggatttacacattttgtttt |
6358437 |
T |
|
| Q |
143 |
agatacggttatgatgtttttgtggatttgactctctcgtaatgtatctctgaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358438 |
agatacggttatgatgtttttgtggatttgactctctcgtaatgtatctctgaa |
6358491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 202 - 330
Target Start/End: Original strand, 6358531 - 6358660
Alignment:
| Q |
202 |
ataccatttgtgacgtcttattatcccatttctttgttatttttctaatcatgattttatcatatagctgcatgc-ttgcccaattcagtgttggctttt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6358531 |
ataccatttgtgacgtcttattatcccatttctttgttatttttctaatcatgattttatcatatagctgcatgctttgcccaattcagtgttggctttt |
6358630 |
T |
|
| Q |
301 |
gagggaaagatagcatcagtaggtgatttg |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6358631 |
gagggaaagatagcatcagtaggtgatttg |
6358660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University