View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_low_47 (Length: 304)
Name: NF3296_low_47
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_low_47 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 292
Target Start/End: Original strand, 586399 - 586690
Alignment:
| Q |
1 |
cttaccgaaaccaagtaaaaatggcagaaattctaatcccttcttaatgtatccccaggaccggactgggatgcaaccattgaatgcttgtttctagcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
586399 |
cttaccgaaaccaagtaaaaatggcagaaattctaatcccttcttaatgtatccccaggaccggaccgggatgcaaccattgaatgcttgtttctagcaa |
586498 |
T |
 |
| Q |
101 |
ttaaggtttagctatgaagcacgacactgacaccaaacacagacaatgtcaatatcgatagtaatccgagaatatggaattattgagtgtaactgcatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
586499 |
ttaaggtttagctatgaagcacgacactgacaccaaacacagacaatgtcaatatcgatagtaatccgagaatatggaattattgagtgtaactgcatgt |
586598 |
T |
 |
| Q |
201 |
gtctgtgttggactcatacacatgtcgaatatcggctacatggacaatatgaagtttttgctgacaacggtgaacgtctgggaacttattga |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
586599 |
gtctgtgttggactcatacacatgtcgaatatcggctacatggacaatatgaagtttttgctgacaacggtgaacgtctgggaacttattga |
586690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University