View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3296_low_47 (Length: 304)

Name: NF3296_low_47
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3296_low_47
NF3296_low_47
[»] chr6 (1 HSPs)
chr6 (1-292)||(586399-586690)


Alignment Details
Target: chr6 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 292
Target Start/End: Original strand, 586399 - 586690
Alignment:
1 cttaccgaaaccaagtaaaaatggcagaaattctaatcccttcttaatgtatccccaggaccggactgggatgcaaccattgaatgcttgtttctagcaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
586399 cttaccgaaaccaagtaaaaatggcagaaattctaatcccttcttaatgtatccccaggaccggaccgggatgcaaccattgaatgcttgtttctagcaa 586498  T
101 ttaaggtttagctatgaagcacgacactgacaccaaacacagacaatgtcaatatcgatagtaatccgagaatatggaattattgagtgtaactgcatgt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
586499 ttaaggtttagctatgaagcacgacactgacaccaaacacagacaatgtcaatatcgatagtaatccgagaatatggaattattgagtgtaactgcatgt 586598  T
201 gtctgtgttggactcatacacatgtcgaatatcggctacatggacaatatgaagtttttgctgacaacggtgaacgtctgggaacttattga 292  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
586599 gtctgtgttggactcatacacatgtcgaatatcggctacatggacaatatgaagtttttgctgacaacggtgaacgtctgggaacttattga 586690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University