View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_low_53 (Length: 288)
Name: NF3296_low_53
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_low_53 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 136 - 288
Target Start/End: Complemental strand, 29356079 - 29355927
Alignment:
| Q |
136 |
tgtgatgaaggggttaaaattcaatgtaaataagtacgtaataagggaccatgaaggtatgtacacgcctacattagctttgaaatttcttactttcctt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29356079 |
tgtgatgaaggggttaaaattcaatgtaaataagtacgtaataagggaccatgaaggtatgtacacgcctacattagctttgaaatttctcactttcctt |
29355980 |
T |
|
| Q |
236 |
tttcccttttcagaccatcgtgtctgcttcaaaaattctgcctcacctatctt |
288 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29355979 |
tttaccttttcagaccatcgtgtctgcttcaaaaattctgcctcacctatctt |
29355927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 14 - 91
Target Start/End: Complemental strand, 29356200 - 29356123
Alignment:
| Q |
14 |
ggaatgatgtatcagagaagatgatgcaaatatttcaggcttcaaaaaagcatactcacctcagatgaaggttgaagt |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29356200 |
ggaatgatgtatcagagaagatgatgcaaatatttcaggctttaaaaaagcatactcacctcagatgaaggttgaagt |
29356123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University