View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_low_56 (Length: 275)
Name: NF3296_low_56
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_low_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 40 - 259
Target Start/End: Original strand, 6358705 - 6358930
Alignment:
| Q |
40 |
ttttttatctcgtctaagtagaagttaccatttgcaataataagttcacttatagagcaagaaatgtcattcaaagattatttatgcatactcagcaaaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358705 |
ttttttatctcgtctaagtagaagttaccatttgcaataataagttcacttatagagcaagaaatgtcattcaaagattatttatgcatactcagcaaaa |
6358804 |
T |
 |
| Q |
140 |
cttggattcgagacc------tttgnnnnnnnnnnnnncttgatctgtctaaactgaagatggaaaatcattccaatgccaagaatgtgggttagttagg |
233 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358805 |
cttggattcgagaccttttttttttttttttttttcttcttgatctgtctaaactgaagatggaaaatcattccaatgccaagaatgtgggttagttagg |
6358904 |
T |
 |
| Q |
234 |
tacaaggaacagataaagcaaatttc |
259 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
6358905 |
tacaaggaatagataaagcaaatttc |
6358930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 190 - 257
Target Start/End: Complemental strand, 32857631 - 32857564
Alignment:
| Q |
190 |
aagatggaaaatcattccaatgccaagaatgtgggttagttaggtacaaggaacagataaagcaaatt |
257 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
32857631 |
aagatggaaaagcatttcaatgccaagaatgtgggttagttagagacaaggaagagataaagcaaatt |
32857564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University