View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_low_59 (Length: 269)
Name: NF3296_low_59
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_low_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 36703207 - 36702967
Alignment:
| Q |
18 |
aggaggaagcacttatcctccaaacgtgtgtaagttataatccaagttttccttcaacactcatgttgaattaaggcagttgaggaaacacaatgcttat |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36703207 |
aggaggaagcacttatcctccaaacatgtgtaagttataatccaagtcttccttcaacactcatgttgaattaaggcagttgaggaaacacaatggttat |
36703108 |
T |
 |
| Q |
118 |
tgatgaggaggtggaaatttgatctctactctttcttgtgtttgattcgaagggttaatttgcatgtgttgcggttcatcatagttagcacaagctttct |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36703107 |
tcatgaggaggtggaaatttgatctctactctttcttgtgtttgattcgaagggttaatttgcatgtgttgcggttcatcatagttagcacaagctttct |
36703008 |
T |
 |
| Q |
218 |
ttcctcataaccctcacattgatgaaatttctcgagtctct |
258 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
36703007 |
ttcctcacaaccctcacatcgatgaaatttctcgagtctct |
36702967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University