View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_low_72 (Length: 245)
Name: NF3296_low_72
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_low_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 38612707 - 38612931
Alignment:
| Q |
19 |
caattatgatctacaatggaagagtagcttgtgtgtttctttatgatttcttgttttttgacctattaatgttgcaattgtttactaacttcagttttgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612707 |
caattatgatctacaatggaagagtagcttgtgtgtttctttatgatttcttgttttttgacctattaatgttgcaattgtttactaacttcagttttgc |
38612806 |
T |
 |
| Q |
119 |
aaatatgggagtcgtgattatctgtgcaatttatcttttgacgcttctctcgaaaacaaatttagttagtgttagcccctttgttgcatcgacatttctg |
218 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38612807 |
aaatatggtagtcgtgattatctgtgcaatttatcttttgatgtttctctcgaaaacaaatttagttagtgttagcccctttgtagcatcgacatttctg |
38612906 |
T |
 |
| Q |
219 |
atctaaggcatgtttggtgtccgac |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38612907 |
atctaaggcatgtttggtgtccgac |
38612931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University