View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_low_74 (Length: 240)
Name: NF3296_low_74
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_low_74 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 45471985 - 45472204
Alignment:
| Q |
19 |
ggaataaattcgaattcatcctaggaatcgtagtttatttaagagtggttgttggggtgaactggtaggtgatgatggtatgaattgtgagctcatagaa |
118 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45471985 |
ggaataaattcgatatcatcctaggaatggtagtttatttaagagtggttgttggggtgaactggtaggtgatgatggtatgaattgtgagctcatagaa |
45472084 |
T |
 |
| Q |
119 |
aaatggtaggtatgaattgtggagtacaacaacctgataaaatccagttgggtttgcaatactcgcatgtagccgtggcctcatagaattcgaattcttt |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45472085 |
aaatggtaggtatgaattgt-gagtacaacaacctgataaaatccagcggggtttgcaatactcgcatgtagccgtggcctcatagaattcgaattcttt |
45472183 |
T |
 |
| Q |
219 |
cattctcggatgagtactacg |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45472184 |
cattctcggatgagtactacg |
45472204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University