View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_low_76 (Length: 239)
Name: NF3296_low_76
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_low_76 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 1251704 - 1251926
Alignment:
| Q |
1 |
caattgttaattacaaatagacacaccaaagtataatattcttaccttagctttccatttgggcttttcttatcagcagggtacatgaatataccaccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251704 |
caattgttaattacaaatagacacaccaaagtataatagtcttaccttagctttccatttgggcttttcttatcagcagggtacatgaatataccaccat |
1251803 |
T |
|
| Q |
101 |
atagcaatgttctatggacatcagctaccatactgcattatgcatttttcgttagcaaataaaatgaagaaacttgaaggaaaaacaagataaaactaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251804 |
atagcaatgttctatggacatcagctaccatactgcattatgcatttttcgttagcaaataaaatgaagaaacttgaaggaaaaacaagataaaactaca |
1251903 |
T |
|
| Q |
201 |
taaagatcagaatcatatacctg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1251904 |
taaagatcagaatcatatacctg |
1251926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 52 - 131
Target Start/End: Complemental strand, 12632404 - 12632325
Alignment:
| Q |
52 |
tttccatttgggcttttcttatcagcagggtacatgaatataccaccatatagcaatgttctatggacatcagctaccat |
131 |
Q |
| |
|
||||||||||| || || || ||||||||||||| || |||| |||||||||||||| | ||| |||||||||||||| |
|
|
| T |
12632404 |
tttccatttggactctttttgtcagcagggtacaaaaaggtacctccatatagcaatgtacgatgaacatcagctaccat |
12632325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University