View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3296_low_84 (Length: 225)

Name: NF3296_low_84
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3296_low_84
NF3296_low_84
[»] chr2 (3 HSPs)
chr2 (24-160)||(22978960-22979096)
chr2 (24-157)||(38458957-38459090)
chr2 (175-212)||(22978906-22978943)
[»] chr5 (1 HSPs)
chr5 (175-212)||(1123657-1123694)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 24 - 160
Target Start/End: Complemental strand, 22979096 - 22978960
Alignment:
24 gaacccttatctcactccttcgatgtgaacctctctatcaaaaccccattgcagaacctctccatgtttctcgaaagccccatcacctctcactcttcgt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22979096 gaacccttatctcactccttcgatgtgaacctctctatcaaaaccccattgcagaacctctccatgtttctcgaaagccccatcacctctcactcttcgt 22978997  T
124 tattcttcccctaccagaacctttgtcacgctcttca 160  Q
    |||||||||||||||||||||||||||||||||||||    
22978996 tattcttcccctaccagaacctttgtcacgctcttca 22978960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 24 - 157
Target Start/End: Complemental strand, 38459090 - 38458957
Alignment:
24 gaacccttatctcactccttcgatgtgaacctctctatcaaaaccccattgcagaacctctccatgtttctcgaaagccccatcacctctcactcttcgt 123  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38459090 gaacccttatctctctccttcgatgtgaacctctctatcaaaaccccattgcagaacctctccatgtttctcgaaagccccatcacctctcactcttcgt 38458991  T
124 tattcttcccctaccagaacctttgtcacgctct 157  Q
    |||||||||||||||| |||||||||||||||||    
38458990 tattcttcccctaccataacctttgtcacgctct 38458957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 212
Target Start/End: Complemental strand, 22978943 - 22978906
Alignment:
175 gcgcaacgcaaaccctcactgtaagcaaaaccctctct 212  Q
    ||||||||||||||||||||||| ||||||||||||||    
22978943 gcgcaacgcaaaccctcactgtatgcaaaaccctctct 22978906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 212
Target Start/End: Original strand, 1123657 - 1123694
Alignment:
175 gcgcaacgcaaaccctcactgtaagcaaaaccctctct 212  Q
    ||||||||| ||||||||||||||||||||||||||||    
1123657 gcgcaacgctaaccctcactgtaagcaaaaccctctct 1123694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University