View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3296_low_89 (Length: 213)
Name: NF3296_low_89
Description: NF3296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3296_low_89 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 46 - 213
Target Start/End: Complemental strand, 1223888 - 1223721
Alignment:
| Q |
46 |
ttgaatactaaaagttaagttatttggatctgctatgagattaatcatcgagtcggtattagatgatctcggtggttaaattaagatcggatgggtcaat |
145 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1223888 |
ttgaatactaaaagttaagttatttggat-tgctatgagattaatcatcgagtcggtattagatgatctcggtggttaaattaagatgggatgggtcaat |
1223790 |
T |
|
| Q |
146 |
tcacgttgaaagatg-nnnnnnngctaattcactataattagaattttggaccccgccaatgttgttaa |
213 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1223789 |
tcacgttgaaagatgttttttttgctaattcactataattaggattttggaccccgccaatgttgttaa |
1223721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University