View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3297_low_6 (Length: 230)
Name: NF3297_low_6
Description: NF3297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3297_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 41 - 213
Target Start/End: Original strand, 9027187 - 9027354
Alignment:
| Q |
41 |
gagggaccatatcatattatatgattagccatacatttgcaaaacatgaagtagtgataaaatgtatatagattaattaaacaatgtatgtctttatcaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9027187 |
gagggaccatatcatattatatgattagccatacatttgcaaaacatgaaatagtgataaaatgtatatagattaattaaacaatgtatgtctttatcaa |
9027286 |
T |
|
| Q |
141 |
aacaaagacaaattaaagttgtcgagatttgtttgttttttacctttatgagcgtgcttcctctttttctcac |
213 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9027287 |
aacaaagac-----aaagttgtcgagatttgtttgttttttacctttatgagcgtgcttcctctttttctcac |
9027354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University