View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3298_high_13 (Length: 239)
Name: NF3298_high_13
Description: NF3298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3298_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 93
Target Start/End: Complemental strand, 25513815 - 25513740
Alignment:
| Q |
18 |
ggttatggtttttgttcaacataattaccatcaagatcgggtccaacatacccttatggtaacattacattctccc |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25513815 |
ggttatggtttttgttcaacataattaccatcaagatcgggtccaacatacccttatggtaacattacattctccc |
25513740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 156 - 239
Target Start/End: Complemental strand, 25513677 - 25513594
Alignment:
| Q |
156 |
aattggggatgtgatcatggttcttaattgcataaatcttaatattgtagcaaatgcaaccgcaattgtagttgtaatatcgtt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
25513677 |
aattggggatgtgatcatggttctaaattgcataaatcttaatattgtagcaaatgcgaccgcaattgtagttctaatatcgtt |
25513594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University