View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3298_low_15 (Length: 239)

Name: NF3298_low_15
Description: NF3298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3298_low_15
NF3298_low_15
[»] chr2 (2 HSPs)
chr2 (18-93)||(25513740-25513815)
chr2 (156-239)||(25513594-25513677)


Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 93
Target Start/End: Complemental strand, 25513815 - 25513740
Alignment:
18 ggttatggtttttgttcaacataattaccatcaagatcgggtccaacatacccttatggtaacattacattctccc 93  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25513815 ggttatggtttttgttcaacataattaccatcaagatcgggtccaacatacccttatggtaacattacattctccc 25513740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 156 - 239
Target Start/End: Complemental strand, 25513677 - 25513594
Alignment:
156 aattggggatgtgatcatggttcttaattgcataaatcttaatattgtagcaaatgcaaccgcaattgtagttgtaatatcgtt 239  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||    
25513677 aattggggatgtgatcatggttctaaattgcataaatcttaatattgtagcaaatgcgaccgcaattgtagttctaatatcgtt 25513594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University