View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3298_low_4 (Length: 350)
Name: NF3298_low_4
Description: NF3298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3298_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 1 - 345
Target Start/End: Complemental strand, 42590761 - 42590417
Alignment:
| Q |
1 |
tttcttctactaccaaccaacattctccaacgtccatctttacccatccaagcagttgttgggtcacgaaaagcgctaccattaacaccttgtcccgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42590761 |
tttcttctactaccaaccaacattctccaacgtccatctttacccatccaagcagttgttgggtcacgaaaagcgctaccattaacaccttgtcccgcaa |
42590662 |
T |
 |
| Q |
101 |
tcacaattgggttgatcgcatcgggttttatccattttctaagaagtgggtcggttggatcttcgggtatcgcatagacttgaacttgggtannnnnnnc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42590661 |
tcacaattgggttgatcgcatcgggttttatccattttctaagaagtgggtcggttggatcttcgggtatcgcatagacttgaacttgggtatttttttc |
42590562 |
T |
 |
| Q |
201 |
atcgataattccggtgtaaaggatcacgggtcctttacccggaacaatagtggctgacccggaccaacatccgtatttgtcgaagggtttagatgggtag |
300 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42590561 |
atcgataattccggtgtaaaggatcactggtcctttacccggaacaatagtggctgacccggaccaacatccgtatttgtcgaagggtttagatgggtag |
42590462 |
T |
 |
| Q |
301 |
atagcaggttcaagtgctttccagtttataagatcctttgatact |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42590461 |
atagcaggttcaagtgctttccagtttataagatcctttgatact |
42590417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 250 - 345
Target Start/End: Original strand, 25952591 - 25952686
Alignment:
| Q |
250 |
gtggctgacccggaccaacatccgtatttgtcgaagggtttagatgggtagatagcaggttcaagtgctttccagtttataagatcctttgatact |
345 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||||| |||||||| | ||||||| |||| ||||||| || || ||||||||||||||| |
|
|
| T |
25952591 |
gtggccgacccggaccaacaaccgtatttgtcaaagggtttggatgggtatagtgcaggttgaagttctttccaattgatgagatcctttgatact |
25952686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University