View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3298_low_5 (Length: 328)
Name: NF3298_low_5
Description: NF3298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3298_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 24224497 - 24224168
Alignment:
| Q |
1 |
ttgagattggtcgccgtctttatttaaagcagaagtgatttcaatgattcatgtatgtt------------ttgttttatctttgtgatttttcagtgct |
88 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24224497 |
ttgagattggtcgccgtctttattcaaagcagaattgatttcaatgattcatgtatgttctgtgtttggttttgttttatctttgtgatttttcagtgct |
24224398 |
T |
|
| Q |
89 |
gttatttatacttgaatgaatgtgttagatttggggaatttttcttgtgtgtttgttatgtgtgttaattacagttattgtttctggatgttggattgaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24224397 |
gttatttatacttgaatgaatgtgttagatttggggaatttttcttgtgtgtttgttatgtgtgttaattacagttattgtttctggatgttggattgaa |
24224298 |
T |
|
| Q |
189 |
gtcattaaaacttaagatttgatggatttatcatttgtgcctgtttttcttttctttgtctacttttctgtatggttagtttttggatttggaactgtcg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24224297 |
gtcattaaaacttaagatttgatggatttatcatttgtgcctgtttttcttttctttgtctacttttctgtatggttagtttttggatttgaaactgtcg |
24224198 |
T |
|
| Q |
289 |
aatatgttatttcgtgtgtttgattctctg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24224197 |
aatatgttatttcgtgtgtttgattctctg |
24224168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 228
Target Start/End: Complemental strand, 24215444 - 24215395
Alignment:
| Q |
179 |
ttggattgaagtcattaaaacttaagatttgatggatttatcatttgtgc |
228 |
Q |
| |
|
|||||||||||| |||||||||| |||||||| |||||| ||| |||||| |
|
|
| T |
24215444 |
ttggattgaagttattaaaacttcagatttgaaggatttttcaattgtgc |
24215395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 62 - 98
Target Start/End: Complemental strand, 24215611 - 24215575
Alignment:
| Q |
62 |
gttttatctttgtgatttttcagtgctgttatttata |
98 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
24215611 |
gttttatctttgtgattttttagtgctgttatatata |
24215575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University